Quantcast

Homemade PCR Test for Mycoplasma Contamination

Mycoplasma is one of the biggest threats to cell culture – feared by most researchers who do such experiments.

Mycoplasma contamination is relatively common and can persist for a long time while remaining undetected. Typically, one infected culture can spread to other cultures when improper working techniques are used. Besides proper safety measures (putting new cell lines into quarantines, disinfecting the work bench when working with different cell lines, aliquoting media…) it is quite easy to test cell cultures for the presence of mycoplasma using PCR.

While commercial test kits are quite easy and fast, they are often too expensive for most labs for routine testing. Commercial kits are unnecessary however, as primer sequences for mycoplasma detection have been published along with routine protocols.

Below is a protocol I have derived from Uphoff and Drexler1,2. I recommend doing this test routinely every few weeks and on every new culture to test for contamination. If there is any doubt, you can also start testing media, sera and so on.

Order Primers

You will need to order multiple forward and reverse primers to detect multiple species of mycoplasma.

Forward primers

  •    Myco-5-1   CGCCTGAGTAGTACGTTCGC
  •    Myco-5-2  CGCCTGAGTAGTACGTACGC
  •    Myco-5-2  TGCCTGAGTAGTACATTCGC
  •    Myco-5-2  TGCCTGGGTAGTACATTCGC
  •    Myco-5-5  CGCCTGGGTAGTACATTCGC
  •    Myco-5-6  CGCCTGAGTAGTATGCTCGC

 Reverse primers

  •    Myco-3-1  GCGGTGTGTACAAGACCCGA
  •    Myco-3-2  GCGGTGTGTACAAAACCCGA
  •    Myco-3-3  GCGGTGTGTACAAACCCCGA

Prepare Primer Mix

Dissolve each primer to a final concentration of 100 µM. Mix all forward primers together to reach a final concentration of 10 µM each. For example, if you want to prepare 100 µl primer mix, take 10 µl of each forward primer and add 40 µl of water. Mix all reverse primers in a similar fashion.

Prepare Sample

Take 100 µl of cell culture supernatant from a dense culture (80-100% confluent) into a 1.5ml tube (or media, sera, whatever you want to test). Heat the sample for 5 min at 95°C (to denaturate it) and spin it for 2min in a bench centrifuge at maximum speed.

Set up PCR

Prepare the PCR reaction mix using the following table (may need some adjustment depending on the manufacturer). Remember to include a negative control sample with water to exclude false positives and a positive control if you have one (If you identify an infected culture you can also use this supernatant as a positive control.)

ReagentVolume (microliters)
10x PCR Buffer2.5
25 mM MgCl 22.0
10mM dNTPs1.0
Forward primers1.0
Reverse primers1.0
Cell culture supernatant2.0
Taq polymerase0.2
Water15.3
Total25

Perform PCR and Run Gel

Perform the PCR using the following program:

StepTemperature (Celsius)Time
Initial denaturation952:00 min
5 cycles940:30 sec
500:30 sec
720:35 sec
30 cycles940:15 sec
560:15 sec
720:30 sec
Store4Infinity
  • The final PCR should be about 500 nucleotides, so you may need to adapt the extention time based on the recommendations for your polymerase. For the Taq polymerase you need about 35 seconds of amplification time (already including some safety margin).
  • The PCR goes through 5 cycles with lower specificity to ensure that the multiple mycoplasma species can be amplified and then through additional 30 cycles with higher specificity to avoid false positives.
  • If the signal is too weak,  you can use 35 cycles instead of 30.

Run the samples on a 1.5% agarose gel. An example is shown below:

Contam pict

Figure 1. Image showing mycoplasma contamination as detected by PCR.

 

Hopefully your samples won’t be contaminated, but if they are, Andrew Porterfield’s article on Attacking Mycoplasma Infections will tell you how to cope with it.

References

  1. Uphoff CC, Drexler HG. (2002) Comparative PCR analysis for detection of mycoplasma infections in continuous cell lines. In Vitro Cell Dev Biol Animl. 38(2): 79-85.
  2. Uphoff CC, Drexler HG. (2004) Detecting Mycoplasma contamination in cell cultures by polymerase chain reaction. Methods Mol Med. 88: 319-326.

9 Comments

  1. Guo Hong on August 29, 2018 at 1:02 pm

    I getting bands at 250bp. What could that be?

  2. Laurine B on October 25, 2016 at 8:35 am

    This is a very good protocol.
    Can you inform me on potential positive control ?
    Best regards,

  3. SCHNEIDER on June 28, 2016 at 12:44 pm

    Thanks for this protocol.
    But we have amplification in our negative control (only water) and in no heat sample too.
    Do you have an explanation ?

    • PL on January 23, 2018 at 11:20 pm

      I have the same problem….

    • harpbelle on February 17, 2018 at 3:54 am

      If the band you see is 30-50bp it is probably primer dimers

      • LAB on July 24, 2018 at 11:56 pm

        For us, it is the same problem. It is impossible to get a good negative control, we have tried to change everything, the polymerase, buffers, water, sterilization processes etc. and we still see the band at 500 bp in the sterile water sample.

        • Andrew on August 3, 2018 at 5:57 am

          did you find a solution for the band occurrence in the negative control?

  4. Arrate on March 11, 2016 at 11:50 am

    This is very useful protocol. Thank you for sharing.
    I would like to ask you if you know which are the species detected by this protocol.

  5. Nicola H on March 10, 2016 at 10:52 am

    This is great, thank you.
    I will be implementing it in our lab to cut down on costs from using the commercial kit.

Leave a Comment





This site uses Akismet to reduce spam. Learn how your comment data is processed.

Share via
Copy link