Skip to content

How to Calculate a DNA Primer Concentration

How to Calculate a DNA Primer Concentration

Calculations can be the bane of laboratory work. Fortunately, there are many easy methods to help you do the maths you need in the lab. Here, we tell you about the different ways to calculate primer concentration depending on the starting material.

For all calculations, let’s assume we have 22 nmol of a DNA primer containing 16 bases.

From Lyophilized Powder

Primers that you purchase from companies will often arrive as lyophilized powders, and the company will tell you how many nmoles of primer they have provided.  If you are confident that you have recovered all of the powder and have had no previous issues with the amount of primer sent, then a quick resuspension and calculation can be done without measuring the OD of the primer. However, if your downstream application with the primer is highly sensitive to primer concentration, or if you are unsure of the primer quality, you should measure the OD of the primer after resuspension and use the second method below for calculation.

Method 1)   Resuspend the primer in 100 µl of water or buffer and use the following calculation:

(XX nmol/100 µl) x (1000 pmol/nmol)= pmol/µl = µM

Example: (22 nmol/100 µl) x (1000 pmol/nmol) = 220 pmol/µl = 220 µM

Method 2)   Alternatively, you can quickly resuspend the primer to a concentration of 100 µM by resuspending the powder in a volume in microliters that is 10x the number of nmol.

Example: Resuspend the 22nmol of primer in 220 µl=100 µM

From a Liquid

Sometimes we are not as careful and organized as we should be and we find tubes of primers in the freezer without concentrations written on them. Occasionally, you may even find that you don’t recover the full amount of lyophilized primer that was sent from a company. In these cases, you can easily calculate the primer concentration from an OD260 reading. Let’s assume that we dilute the primer from above 1:200 and the OD260 reading was 0.132.

The concentration can be calculated using the following formulas:

(OD260) x (0.02*) x (dilution factor) = µg/µl       *Conversion factor for single stranded DNA

(µg/µl/330Daltons/nt**) x (106/# of nt) = µM    **Average molecular weight per nucleotide

Example:  (0.132)(0.02)(200)=0.528 µg/µl

(0.528/330) x (106/16)= 100 µM

Questions? Let us know below in the comments section!

Originally published in 2013. Updated and republished in 2017.

Image Credit: Dylan231


  1. asif jokhio on October 31, 2018 at 6:38 pm

    kindly suggest how can i prepare FISH probes stock solution

  2. Ramesh kumawat on October 25, 2017 at 12:05 pm

    thanks,it was really helpful.

  3. Minal on August 22, 2017 at 7:36 am

    Will you please help me to calculate total OD of the oligonucleotide?
    e.g. I got 71.4 nmol lyophilized oliognucleotide. I have reconstittued it in 714 ul of TE buffer to make 100uM stock.
    Then I took OD of 2ul of solution using Multiscan (Nanodrop sphectrophotometer) which is 0.942. So How to calculate total OD of the whole solution? As company mentioned around 13 OD yield.

    Please suggest the calculation. Thank you

  4. Hovig Jrjian on June 24, 2017 at 7:39 pm

    I made a mistake and I diluted my primers by an extra factor of 10, as I was given the wrong info in the lab. How can I reconcentrate them if that’s a possibility? Or anything ideas would help.

    • Dr Amanda Welch on June 28, 2017 at 4:51 pm

      You can likely just add more of your primers. Replace some of the water that you add to the reaction with your primers.

      • Iqbal on March 31, 2018 at 8:03 pm

        why 10x of nuclease free water added to reconstitute the primer???
        not used 20x or 50x …..why 10x….???

        • Dr Amanda Welch on April 2, 2018 at 3:19 pm

          It depends on the parameters of your reaction. Also, it’s easier to pipette larger volumes more accurately than smaller. For example, a 50 uL reaction needs 5 uL of 10X primers but 2.5 uL of 20X primers, and 1 uL of 50X primers. 5 uL is easier to accurately pipette. Does that make sense?

  5. Vanessa on May 21, 2017 at 8:07 pm

    The # of nt in the equation ; (106/# of nt) is the number of nucleotides in the primer and it is variable depending on the length of primer isn’t it ?

  6. pre on January 15, 2017 at 5:24 pm

    i have followed the method 1 from lyophilized powder.
    now i would like to know from this how to make 3.28uM/ul. using this 22nmol as example

  7. haider on November 2, 2016 at 4:41 am

    thank you for this information , my question i have this data primer sequences with optical density and concentration , i will attach them to you , but how can i diluted them depend on formula 2 ((OD260) x (0.02*) x (dilution factor) = ug/ul *Conversion factor for single stranded DNA), i used the formula type one is ok.
    Oligo Name Sequence, 5′ to 3′ OD260 μg pmol μl to add for 100 μM solution
    Fhepf GCGGCCAAATATGAGTCA 12.7 381 70504 705
    Fhepr CTGGAGATTCCGGTTACCAA 14.0 443 72504 725
    this is my primer ,please help me

    best wish

  8. Vladimir on April 5, 2016 at 10:32 pm

    The online DNA Calculator can come in handy:

  9. kissmd on March 28, 2013 at 8:22 pm

    Follow up question- can you please address calculating ‘copies per uL’ for example of a custom synthesized miRNA that will be used for qPCR? The packing slip has ugs, nmoles- I see how to make the 100uM stock, but not sure how to compute that into the ‘copies/uL’ need for qPCR, etc. Thanks

Leave a Comment

You must be logged in to post a comment.

This site uses Akismet to reduce spam. Learn how your comment data is processed.

Scroll To Top
Share via
Copy link